Description

Deoxyribonucleic acid (DNA) is formed by two complementary strands of bases twisted into a double helix structure.
There are four types of bases that make up DNA: Adenine (A), Guanine (G), Thymine (T), and Cytosine (C). It is known that on corresponding positions of the two complementary strands, Adenine always pairs with Thymine, and Guanine always pairs with Cytosine.
Your task is to determine the complementary base sequence for a given single strand of DNA.

Input Format

A string representing a single strand of DNA. This string consists only of uppercase letters A, T, G, and C, denoting Adenine, Thymine, Guanine, and Cytosine, respectively. The length of the string does not exceed 255.

Output Format

A string consisting only of uppercase letters A, T, G, and C, representing the complementary strand of the input DNA sequence.

ATATGGATGGTGTTTGGCTCTG

TATACCTACCACAAACCGAGAC