Description

To determine the functional and structural similarities between gene sequences, it is often necessary to align several different DNA sequences to assess whether the aligned DNA sequences are related.

Now, align two DNA sequences of the same length. Define the bases at the same position in the two DNA sequences as a base pair. If the two bases in a base pair are identical, it is called a matching base pair. Then calculate the proportion of matching base pairs relative to the total number of base pairs. If this proportion is greater than or equal to a given threshold, the two DNA sequences are considered related; otherwise, they are unrelated.

Input Format

There are three lines. The first line is the threshold used to determine whether the two DNA sequences are related. The subsequent two lines are the two DNA sequences (each with a length not exceeding 500).

Output Format

If the two DNA sequences are related, output "yes"; otherwise, output "no".

```input1 0.85 ATCGCCGTAAGTAACGGTTTTAAATAGGCC ATCGCCGGAAGTAACGGTCTTAAATAGGCC

```output1
yes

翻译结果

CodesOnline